plko 1 puro lentiviral vector (Addgene inc)
Addgene inc is a verified supplier 
96
Structured Review
Addgene inc
plko 1 puro lentiviral vector
Plko 1 Puro Lentiviral Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1549 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/plko+1+lentiviral+vector/pLKO%2E1+puro+(Plasmid+%238453)/pm41922512-130-18-21
Average 96 stars, based on 1549 article reviews
Plko 1 Puro Lentiviral Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1549 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/plko+1+lentiviral+vector/pLKO%2E1+puro+(Plasmid+%238453)/pm41922512-130-18-21
Average 96 stars, based on 1549 article reviews
plko 1 puro lentiviral vector - by Bioz Stars,
2026-09
96/100 stars
Images
Related Articles
Gene Expression:Article Title: CEBPB expression in tumor cells drives immune evasion in colorectal cancer via CTLA4 upregulation in T cells Article Snippet: In total, 80 CRC cell lines were selected, and the expression levels of CEBPB and lipocalin-2 (LCN2) were analyzed to assess their correlation using GraphPad Prism 8 (GraphPad Software). .. 2.11 Manipulation of gene expression To establish stable knockdown cell lines, sense and antisense gene-specific short hairpin RNA (shRNA) oligos for Trp53 and Cebpb (Supplementary Table S1) were annealed and ligated into the Knockdown:Article Title: CEBPB expression in tumor cells drives immune evasion in colorectal cancer via CTLA4 upregulation in T cells Article Snippet: In total, 80 CRC cell lines were selected, and the expression levels of CEBPB and lipocalin-2 (LCN2) were analyzed to assess their correlation using GraphPad Prism 8 (GraphPad Software). .. 2.11 Manipulation of gene expression To establish stable knockdown cell lines, sense and antisense gene-specific short hairpin RNA (shRNA) oligos for Trp53 and Cebpb (Supplementary Table S1) were annealed and ligated into the Article Title: CEBPB Expression in Tumor Cells Drives Immune Evasion in Colorectal Cancer via CTLA4 Up-regulation in T Cells Article Snippet: In total, 80 CRC cell lines were selected, and the expression levels of CEBPB and lipocalin-2 ( LCN2 ) were analyzed to assess their correlation using GraphPad Prism 8 (GraphPad Software). .. To establish stable knockdown cell lines , sense and antisense gene-specific short hairpin RNA (shRNA) oligos for Trp53 and Cebpb (Table ) were annealed and ligated into the Article Title: Synaptic vesicles that store monoamines and glutamate differ in protein composition Article Snippet: SCAMP5-specific small hairpin RNA (shRNA) was designed with the aid of the InvivoGen siRNA Wizard Online Tool to target the mouse SCAMP5 cDNA sequence. .. SCAMP5 knock-down (TGCTCTTAGCATGGTTCATAA) and a scrambled control sequences were inserted into the shRNA:Article Title: CEBPB expression in tumor cells drives immune evasion in colorectal cancer via CTLA4 upregulation in T cells Article Snippet: In total, 80 CRC cell lines were selected, and the expression levels of CEBPB and lipocalin-2 (LCN2) were analyzed to assess their correlation using GraphPad Prism 8 (GraphPad Software). .. 2.11 Manipulation of gene expression To establish stable knockdown cell lines, sense and antisense gene-specific short hairpin RNA (shRNA) oligos for Trp53 and Cebpb (Supplementary Table S1) were annealed and ligated into the Article Title: CSE1L regulates gastric cancer progression via molecular crosstalk with TRIP13. Article Snippet: Gastric cancer (GC) is one of the most common malignant tumours worldwide, with adenocarcinoma comprising more than 95 % of cases.. A significant challenge is that most GC patients exhibit no symptoms during early disease stages, underscoring the critical need for reliable biomarkers to enable early diagnosis and the exploration of innovative therapeutic approaches.. CSE1L, a member of the cellular apoptosis susceptibility protein family, interacts with microtubules and mitotic spindles. Article Title: Periostin Promotes Sarcoma Growth by Promoting Tumor-Associated Macrophage Migration and Differentiation Article Snippet: .. Short hairpin RNAs (shRNA) were cloned into the Article Title: CEBPB Expression in Tumor Cells Drives Immune Evasion in Colorectal Cancer via CTLA4 Up-regulation in T Cells Article Snippet: In total, 80 CRC cell lines were selected, and the expression levels of CEBPB and lipocalin-2 ( LCN2 ) were analyzed to assess their correlation using GraphPad Prism 8 (GraphPad Software). .. To establish stable knockdown cell lines , sense and antisense gene-specific short hairpin RNA (shRNA) oligos for Trp53 and Cebpb (Table ) were annealed and ligated into the Article Title: Supporting Information for Premature transcription termination complex proteins PCF11 and WDR82 silence HIV-1 expression in latently infected cells Article Snippet: HeLa LTR-Luc cells were transfected for 72 h with siRNAs at 10 nM final concentration using Lipofectamine RNAiMAX (Invitrogen, 13778) reagent following the manufacturer’s instructions. .. Production and transduction of pseudotyped viruses Short hairpin RNA sequences from Sigma MISSION® were cloned into the Plasmid Preparation:Article Title: CEBPB expression in tumor cells drives immune evasion in colorectal cancer via CTLA4 upregulation in T cells Article Snippet: In total, 80 CRC cell lines were selected, and the expression levels of CEBPB and lipocalin-2 (LCN2) were analyzed to assess their correlation using GraphPad Prism 8 (GraphPad Software). .. 2.11 Manipulation of gene expression To establish stable knockdown cell lines, sense and antisense gene-specific short hairpin RNA (shRNA) oligos for Trp53 and Cebpb (Supplementary Table S1) were annealed and ligated into the Article Title: Periostin promotes sarcoma growth by promoting tumor-associated macrophage migration and differentiation Article Snippet: The genes were amplified from the cDNA of mouse mesenchymal cells and cloned into the retroviral vector by using the Gibson Assembly kit (New England Biolabs). .. The expression of the transgene was assessed by RT-qPCR. shRNAs were cloned into the Article Title: CSE1L regulates gastric cancer progression via molecular crosstalk with TRIP13. Article Snippet: Gastric cancer (GC) is one of the most common malignant tumours worldwide, with adenocarcinoma comprising more than 95 % of cases.. A significant challenge is that most GC patients exhibit no symptoms during early disease stages, underscoring the critical need for reliable biomarkers to enable early diagnosis and the exploration of innovative therapeutic approaches.. CSE1L, a member of the cellular apoptosis susceptibility protein family, interacts with microtubules and mitotic spindles. Article Title: Periostin Promotes Sarcoma Growth by Promoting Tumor-Associated Macrophage Migration and Differentiation Article Snippet: .. Short hairpin RNAs (shRNA) were cloned into the Article Title: CEBPB Expression in Tumor Cells Drives Immune Evasion in Colorectal Cancer via CTLA4 Up-regulation in T Cells Article Snippet: In total, 80 CRC cell lines were selected, and the expression levels of CEBPB and lipocalin-2 ( LCN2 ) were analyzed to assess their correlation using GraphPad Prism 8 (GraphPad Software). .. To establish stable knockdown cell lines , sense and antisense gene-specific short hairpin RNA (shRNA) oligos for Trp53 and Cebpb (Table ) were annealed and ligated into the Article Title: FUBP3-Mediated Recruitment of STAT3 Complex Formation to Activate EMT Factor Twist1 and Promote Lung Cancer Metastasis Article Snippet: .. The control sequence was a scrambled nonspecific sequence, which was cloned into the Expressing:Article Title: Periostin promotes sarcoma growth by promoting tumor-associated macrophage migration and differentiation Article Snippet: The genes were amplified from the cDNA of mouse mesenchymal cells and cloned into the retroviral vector by using the Gibson Assembly kit (New England Biolabs). .. The expression of the transgene was assessed by RT-qPCR. shRNAs were cloned into the Clone Assay:Article Title: Periostin promotes sarcoma growth by promoting tumor-associated macrophage migration and differentiation Article Snippet: The genes were amplified from the cDNA of mouse mesenchymal cells and cloned into the retroviral vector by using the Gibson Assembly kit (New England Biolabs). .. The expression of the transgene was assessed by RT-qPCR. shRNAs were cloned into the Article Title: Periostin Promotes Sarcoma Growth by Promoting Tumor-Associated Macrophage Migration and Differentiation Article Snippet: .. Short hairpin RNAs (shRNA) were cloned into the Article Title: FUBP3-Mediated Recruitment of STAT3 Complex Formation to Activate EMT Factor Twist1 and Promote Lung Cancer Metastasis Article Snippet: .. The control sequence was a scrambled nonspecific sequence, which was cloned into the Article Title: Supporting Information for Premature transcription termination complex proteins PCF11 and WDR82 silence HIV-1 expression in latently infected cells Article Snippet: HeLa LTR-Luc cells were transfected for 72 h with siRNAs at 10 nM final concentration using Lipofectamine RNAiMAX (Invitrogen, 13778) reagent following the manufacturer’s instructions. .. Production and transduction of pseudotyped viruses Short hairpin RNA sequences from Sigma MISSION® were cloned into the Control:Article Title: CSE1L regulates gastric cancer progression via molecular crosstalk with TRIP13. Article Snippet: Gastric cancer (GC) is one of the most common malignant tumours worldwide, with adenocarcinoma comprising more than 95 % of cases.. A significant challenge is that most GC patients exhibit no symptoms during early disease stages, underscoring the critical need for reliable biomarkers to enable early diagnosis and the exploration of innovative therapeutic approaches.. CSE1L, a member of the cellular apoptosis susceptibility protein family, interacts with microtubules and mitotic spindles. Article Title: Synaptic vesicles that store monoamines and glutamate differ in protein composition Article Snippet: SCAMP5-specific small hairpin RNA (shRNA) was designed with the aid of the InvivoGen siRNA Wizard Online Tool to target the mouse SCAMP5 cDNA sequence. .. SCAMP5 knock-down (TGCTCTTAGCATGGTTCATAA) and a scrambled control sequences were inserted into the Article Title: FUBP3-Mediated Recruitment of STAT3 Complex Formation to Activate EMT Factor Twist1 and Promote Lung Cancer Metastasis Article Snippet: .. The control sequence was a scrambled nonspecific sequence, which was cloned into the Synthesized:Article Title: CSE1L regulates gastric cancer progression via molecular crosstalk with TRIP13. Article Snippet: Gastric cancer (GC) is one of the most common malignant tumours worldwide, with adenocarcinoma comprising more than 95 % of cases.. A significant challenge is that most GC patients exhibit no symptoms during early disease stages, underscoring the critical need for reliable biomarkers to enable early diagnosis and the exploration of innovative therapeutic approaches.. CSE1L, a member of the cellular apoptosis susceptibility protein family, interacts with microtubules and mitotic spindles. Sequencing:Article Title: FUBP3-Mediated Recruitment of STAT3 Complex Formation to Activate EMT Factor Twist1 and Promote Lung Cancer Metastasis Article Snippet: .. The control sequence was a scrambled nonspecific sequence, which was cloned into the Transduction:Article Title: Supporting Information for Premature transcription termination complex proteins PCF11 and WDR82 silence HIV-1 expression in latently infected cells Article Snippet: HeLa LTR-Luc cells were transfected for 72 h with siRNAs at 10 nM final concentration using Lipofectamine RNAiMAX (Invitrogen, 13778) reagent following the manufacturer’s instructions. .. Production and transduction of pseudotyped viruses Short hairpin RNA sequences from Sigma MISSION® were cloned into the |